View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18716_low_18 (Length: 233)
Name: NF18716_low_18
Description: NF18716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18716_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 12774356 - 12774157
Alignment:
| Q |
19 |
ttatttgaagaaacttgcttggtgttccaggttggtttctccttttcttctgaggtggtgcagttggagttgttgatgatgaaggtgttgatgaattctg |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12774356 |
ttatatgaagaaacttgcttggtgttccaggttggtttctccttttcttctgaggtggtgcagttggagttgttgatgatgaaggtgttgatgaattctg |
12774257 |
T |
 |
| Q |
119 |
ttgattcatctgattctgatcctcttgtgagattgtaaagaaagatgcagctgaaaatgatgttgccatatctaaagaaaaatcaagaagctgaagtaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12774256 |
ttgattcatctgattctgatcctcttgtgagattgtaaagaaagatgcagctgaaaatgatgttgccatatctatagaaaaatcaagaagctgaagtaga |
12774157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 50789699 - 50789754
Alignment:
| Q |
26 |
aagaaacttgcttggtgttccaggttggtttctccttttcttctgaggtggtgcag |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
50789699 |
aagaaacttgcttggtgttccaggttggtttctctttttcttcggagctggtgcag |
50789754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University