View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18716_low_19 (Length: 230)
Name: NF18716_low_19
Description: NF18716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18716_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 25660303 - 25660102
Alignment:
| Q |
16 |
aatatcatgaaaatgtggctgaaaacacctaataaacttcaacgaaatcaatgttatcacccccaaaatcgcatgaagtaacgctaacgaagttctatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25660303 |
aatatcatgaaaatgtggctgaaaacacctaataaacttcaacgaaatcaatgttatcacccccaaaatcgcatgaagtaacgctaacgaagttctgtca |
25660204 |
T |
|
| Q |
116 |
tcttctaaaagcgcctggcacgctttgagaataggtaaagcataccgttcatttccaccgacgttgagaaactcgcgcaaaccttgtagcgcgagttcct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25660203 |
tcttctaaaagcgcctggcacgctttgagaataggtaaagcataccgttcattaccaccgacgttaagaaactcgcgcaaaccttgtagcgcgagttcct |
25660104 |
T |
|
| Q |
216 |
tt |
217 |
Q |
| |
|
|| |
|
|
| T |
25660103 |
tt |
25660102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University