View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18716_low_19 (Length: 230)

Name: NF18716_low_19
Description: NF18716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18716_low_19
NF18716_low_19
[»] chr4 (1 HSPs)
chr4 (16-217)||(25660102-25660303)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 25660303 - 25660102
Alignment:
16 aatatcatgaaaatgtggctgaaaacacctaataaacttcaacgaaatcaatgttatcacccccaaaatcgcatgaagtaacgctaacgaagttctatca 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
25660303 aatatcatgaaaatgtggctgaaaacacctaataaacttcaacgaaatcaatgttatcacccccaaaatcgcatgaagtaacgctaacgaagttctgtca 25660204  T
116 tcttctaaaagcgcctggcacgctttgagaataggtaaagcataccgttcatttccaccgacgttgagaaactcgcgcaaaccttgtagcgcgagttcct 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
25660203 tcttctaaaagcgcctggcacgctttgagaataggtaaagcataccgttcattaccaccgacgttaagaaactcgcgcaaaccttgtagcgcgagttcct 25660104  T
216 tt 217  Q
    ||    
25660103 tt 25660102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University