View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18716_low_21 (Length: 210)
Name: NF18716_low_21
Description: NF18716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18716_low_21 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 15481477 - 15481302
Alignment:
| Q |
19 |
atgcactgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaattgttgaagcatggtaattgagtgcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15481477 |
atgcactgctacttcaactctctttcttcctctcattcttaccaccaccgcacaccactaggctgctgccggaattgttgaagcatggtaattgagtgcc |
15481378 |
T |
 |
| Q |
119 |
atcactctgatcctcttatactcaacaccaaatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15481377 |
atcactctgttcctcttatactcaacaccagatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
15481302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 15481176 - 15481249
Alignment:
| Q |
19 |
atgcactgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
15481176 |
atgcactgctacttcaactctctttcttcctctcattttgaccaccaccacacaccactaggttgctgccggaa |
15481249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 10421470 - 10421426
Alignment:
| Q |
48 |
ctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
10421470 |
ctctctttctgaccaccactgcacaccactaggctgctgccggaa |
10421426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 38337383 - 38337208
Alignment:
| Q |
19 |
atgcactgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaattgttgaagcatggtaattgagtgcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38337383 |
atgcactgctacttcaactctctttcttcctctcattctaaccaccaccgcacaccactaggctgctgccggaattgttgaagcatggtaattgagtgcc |
38337284 |
T |
 |
| Q |
119 |
atcactctgatcctcttatactcaacaccaaatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38337283 |
atcactctgttcctcttatactcaacaccagatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
38337208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 38337088 - 38337157
Alignment:
| Q |
23 |
actgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38337088 |
actgctacttcaactctctttcttcctctcattctgaccaccaccgcacaccactaggctgctgccggaa |
38337157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 43924924 - 43924749
Alignment:
| Q |
19 |
atgcactgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaattgttgaagcatggtaattgagtgcc |
118 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43924924 |
atgcaccgctacttcaactctcttttttcctctcattctgaccaccaccgcacaccactaggctgctgccggaattgttgaagcatggtaatcgagtgcc |
43924825 |
T |
 |
| Q |
119 |
atcactctgatcctcttatactcaacaccaaatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43924824 |
atcactctgttcctcttatactcaacaccagatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
43924749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 43924629 - 43924698
Alignment:
| Q |
23 |
actgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43924629 |
actgctacttcaactctctttcttcctctcattctgaccatcaccgcacaccactaggctgctgccggaa |
43924698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 27763554 - 27763627
Alignment:
| Q |
19 |
atgcactgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27763554 |
atgcaccgctacttcaactctctttcttcctctcattctgaccaccaccgcacaccactaggctgctgccggaa |
27763627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 108 - 194
Target Start/End: Complemental strand, 27763765 - 27763679
Alignment:
| Q |
108 |
aattgagtgccatcactctgatcctcttatactcaacaccaaatataaatgaagatggtaattgagtgtctgttgattaaactatgt |
194 |
Q |
| |
|
|||||| ||||||||||| | |||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
27763765 |
aattgaatgccatcactccgttcctcttatactcaacaccagatataaatgaaggttgtaattgagtgtctgttgattaaactatgt |
27763679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 27 - 92
Target Start/End: Original strand, 12335 - 12400
Alignment:
| Q |
27 |
ctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12335 |
ctacttcaactctctttcttcctctcattctgaccaccaccgcacaccactaggctgctgccggaa |
12400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 14924815 - 14924884
Alignment:
| Q |
19 |
atgcactgctacttcaactctctttcttcctctcattctgacccccaccgcacaccactaggctgctgccggaa |
92 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
14924815 |
atgcaccgctacttcaactctctt----cctctcattctgaccaccaccacacaccactaggctgctgccggaa |
14924884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University