View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18717_high_27 (Length: 264)
Name: NF18717_high_27
Description: NF18717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18717_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 22042708 - 22042807
Alignment:
| Q |
1 |
tataaccaaaatgagtataatttaatagcttgatnnnnnnnncacaaatactatcaaactacttgtccatttgaaatattgtgtagactaaataaccctt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
22042708 |
tataaccgaaatgagtataatttaatagcttgatcaaaaaa-cacaaatactatcaaactacttctccagttgaaacattgtgtagactaaataaccctt |
22042806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 196 - 237
Target Start/End: Complemental strand, 19894685 - 19894644
Alignment:
| Q |
196 |
tatttaaatgatgtaaaagttataaacatggttagtgcatag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19894685 |
tatttaaatgatgtaaaagttataaacatggttagtgcatag |
19894644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 97
Target Start/End: Complemental strand, 22016343 - 22016298
Alignment:
| Q |
52 |
tatcaaactacttgtccatttgaaatattgtgtagactaaataacc |
97 |
Q |
| |
|
||||||||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
22016343 |
tatcaaactacttgtccatttgaaacatcgggtagactaaataacc |
22016298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University