View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18717_low_14 (Length: 437)
Name: NF18717_low_14
Description: NF18717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18717_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 19 - 425
Target Start/End: Original strand, 32829268 - 32829672
Alignment:
| Q |
19 |
gatggggtattaagggacgaatttggcgcttggatt-gtggtgtggcttggagtatgggttgctgcttggtcctattgactgagatttggggtatcctaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32829268 |
gatggggtattaagggacgaatttggcgcttggatttgtggtgtggcttggagtatgggttgctgcttggtcctattgactgagatttagggtatcctaa |
32829367 |
T |
 |
| Q |
118 |
ctattcttcaaaaattggttgggagaaagattacaaatttgtttcgattgagtcggattcggcactagtaatttcgctacgaacaatgtgtgtcatcctc |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
32829368 |
ctattcttcaaaaattggttgggaaaaagattacaaatttgtttcgattgagtcggattcggcaccagtaatttcgctacgaacaatgtgtatcatcctc |
32829467 |
T |
 |
| Q |
218 |
ctcacccttgcgcctctctcgtctccctcatcaatcatcttatgacgaggcattggcatgtacaagttattcacatctattggcaaagacaacggactga |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32829468 |
ctcacccttgcgcctctctcatctccctcatcaatcatcttatgacgaggcattggcatgtacaagttattcacatctattggcaaagacaacagactga |
32829567 |
T |
 |
| Q |
318 |
attgcaggttacactttttcactacctaaaggttcacatatccttccccacgttgtttatccaggttgtgttaactttttatggcatgatgttgccaatt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32829568 |
attgcaggttacactttttcactacctaaaggttcacatatccttccccac---gtttatccaggttgtgttaactttttatggtatgatgttgccaatt |
32829664 |
T |
 |
| Q |
418 |
tttatttt |
425 |
Q |
| |
|
|||||||| |
|
|
| T |
32829665 |
tttatttt |
32829672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University