View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18717_low_32 (Length: 250)
Name: NF18717_low_32
Description: NF18717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18717_low_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 47973005 - 47973184
Alignment:
| Q |
13 |
aatatctgattagtggaattcagtacgtctgatttttatggaacatttggtaaaaggaagagcgattccatgcaaaaccgtgaaatggaataataatgtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47973005 |
aatatctgattagtggaattcagtacgtctgatttttatggaacatttggtaaaaggaagggcgattccatgcaaaacagtgaaatggaataataatgtc |
47973104 |
T |
|
| Q |
113 |
cagtctaaaacttggcagtttcaataatggggtggcaatatggcattcaattatttggtacatggaatgaatacagaatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47973105 |
cagtctaaaacttggcagtttcaataatggggtggcaatatggcattcaattatttggtacatggaatgaatacagaatg |
47973184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 40849763 - 40849713
Alignment:
| Q |
200 |
tttggttattttcagtttggttcaagtgcagttcacggtttggtttagttt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
40849763 |
tttggttattttcagtttggttcaagtgcagttcatagtttggttcagttt |
40849713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 204 - 240
Target Start/End: Original strand, 12485531 - 12485567
Alignment:
| Q |
204 |
gttattttcagtttggttcaagtgcagttcacggttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
12485531 |
gttattttcagtttggttcaagtgcagattacggttt |
12485567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University