View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18717_low_33 (Length: 238)
Name: NF18717_low_33
Description: NF18717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18717_low_33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 2 - 238
Target Start/End: Complemental strand, 12055761 - 12055525
Alignment:
| Q |
2 |
atatcaccccaacaatccaaaccaccatcatttgagatagcacaaacatggtttgaaccagcttcaataacagaataatttccaccattctttggttcat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12055761 |
atatcaccccaacaatccaaaccaccatcatttgagatagcacaaacatggtttgaaccagcttcaataacagaataatttccaccattctttggttcat |
12055662 |
T |
 |
| Q |
102 |
ttctaacaactctattgttacttcctttgcaagtaacaacattcccttttccattttctaatagcccacatacaaaattctctcccaccgcaatttttga |
201 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
12055661 |
ttccaacaactctattgttacttcctttgcaagtaacaacattcccttttccattttctaatagcccacatacaaaattctctcccaccgcgatatttga |
12055562 |
T |
 |
| Q |
202 |
catgttcatgttcatcccggagcttgaattgaagcct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12055561 |
catgttcatgttcatcccggagcttgaattgaagcct |
12055525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University