View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18717_low_38 (Length: 205)
Name: NF18717_low_38
Description: NF18717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18717_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 830040 - 829866
Alignment:
| Q |
16 |
attctcaaatagctaaagataccattagtctttgtaatcttttcacatttgagtatgacattcataccatttctttttcttgaatagttcttcctgcaga |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
830040 |
attctcaaatagctaaagataccacgagtctttgtaatcttttcacatttgagtatgacattcataccatttctttttcttgaatagttcttcctgcaga |
829941 |
T |
|
| Q |
116 |
tatccatgtatgcctgatctaccgaagcacgctcattcatataagagtaaaagatttactttgcatgcatttatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
829940 |
tatccatgtatgcctgatctaccgaagcacgctcattcatataagagtaaaagatttactttgcatgcatttatt |
829866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 43 - 145
Target Start/End: Complemental strand, 822173 - 822064
Alignment:
| Q |
43 |
gtctttgtaatcttttcacatttgagtatgacattcataccatttctttttcttgaatagttcttcctgcagat-------atccatgtatgcctgatct |
135 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||| ||||||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
822173 |
gtctttgtaatcttttcatatttgtgtatgacattcgtaccatttctccttcttgaatagttcttcgtgcaaataggccccatccatgtatgcctgatct |
822074 |
T |
|
| Q |
136 |
accgaagcac |
145 |
Q |
| |
|
|||||||||| |
|
|
| T |
822073 |
accgaagcac |
822064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University