View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18718_low_4 (Length: 454)
Name: NF18718_low_4
Description: NF18718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18718_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 3e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 248 - 436
Target Start/End: Complemental strand, 38504770 - 38504582
Alignment:
| Q |
248 |
cataaaagtgaatcaaatgattttaagtgatttgatagaacgatcatagtggtattgaaatgatcttgaatgttgatggaagtagcctcgataaccctaa |
347 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38504770 |
cataaaagtgaatcaaatgattttaaatgatttgatggaacgatcatgatggtattgaaatgatcttgaatgttgatgggagtagcctcgataaccctag |
38504671 |
T |
 |
| Q |
348 |
tatttcaagctttggggaattgattcgaaattctgatgatgcttggttccatgagtttgtgggtaatataggattctccaacatcctcc |
436 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38504670 |
tatttcaaactttggggaattgattcgaaattctgatggtgcttggttccatgagtttgtgggtaatataggattctccaacatcctcc |
38504582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 15 - 141
Target Start/End: Complemental strand, 38505008 - 38504877
Alignment:
| Q |
15 |
caaaggagaataatgcagctagtgacaagatacggacaagaattgcacaaaccatggaatggatcat-----ataactaggaggagcatggggtaatcat |
109 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38505008 |
caaaggagaataatgcagctagtgacaggatacggacaagaattgcacacaccatggaatggatcatataatataactaggaggagcatggggtaatcat |
38504909 |
T |
 |
| Q |
110 |
tccctatagtacaactcgccatcattaaaccg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38504908 |
tccctatagtacaactcgccatcattaaaccg |
38504877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University