View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18718_low_5 (Length: 309)
Name: NF18718_low_5
Description: NF18718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18718_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 88 - 292
Target Start/End: Complemental strand, 32885580 - 32885379
Alignment:
| Q |
88 |
tactttttacataaattcattcacagttattgaatatttggtgatagtaacttacttaggttggtctggtgacacggacttaagatttagaatatactct |
187 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| | |
|
|
| T |
32885580 |
tactttgtacataaatttattcacagttattgaatatttggtgatagtaacttacttaggttggtctg---acactgacttaagatttagaatatacttt |
32885484 |
T |
|
| Q |
188 |
caaagttttagattctattatatctgatgtcaatttggataacactgtattcatcataaaatatcatattgtatctnnnnnnngaaattaagaaatgaaa |
287 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32885483 |
caaagttttagattccattctatctgatgtcaatttggataacactgtattcatcataaaatatcatattatatctaaaaaaagaaattaagaaatgaaa |
32885384 |
T |
|
| Q |
288 |
gatat |
292 |
Q |
| |
|
||||| |
|
|
| T |
32885383 |
gatat |
32885379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 227
Target Start/End: Original strand, 17780871 - 17780912
Alignment:
| Q |
186 |
ctcaaagttttagattctattatatctgatgtcaatttggat |
227 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
17780871 |
ctcaaagttttagattcgattgtttctgatgtcaatttggat |
17780912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University