View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18719_high_21 (Length: 235)
Name: NF18719_high_21
Description: NF18719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18719_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5232519 - 5232301
Alignment:
| Q |
1 |
tgatactgacacatgtgagtacgatcaaatatttcnnnnnnnnncaaattattactggtgttgaagtgtcagtgtcgtgtctgatgtctgtatctatgtt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5232519 |
tgatactgatacatgtgagtacgatcaaatatttcattttttt-caaattattactg-tgttgaagtgtcagtgtcgtgtctgatgtctatatctatgtt |
5232422 |
T |
|
| Q |
101 |
tcatacatcgttcaatttagtattgaatcgagataaacttctatccatattaattaagaaacttctatcaattttctgaaacaaatacctttgttgatct |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5232421 |
tcatagatcgttcaatttagtattgaatcgagataaacttctatccatattaattaagaaacttctatctattttctgaaacaaatacctttgttgatct |
5232322 |
T |
|
| Q |
201 |
cacttgcttcagagatgaatc |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
5232321 |
cacttgcttgagagatgaatc |
5232301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 85
Target Start/End: Complemental strand, 12054349 - 12054309
Alignment:
| Q |
45 |
caaattattactggtgttgaagtgtcagtgtcgtgtctgat |
85 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
12054349 |
caaattattactgctgttgacgtgtcagtgtcgtgtttgat |
12054309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University