View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18719_low_22 (Length: 212)
Name: NF18719_low_22
Description: NF18719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18719_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 94 - 197
Target Start/End: Original strand, 7279143 - 7279246
Alignment:
| Q |
94 |
caactccactttcatcttcaaaatcttgttcaaactcgtcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaatcggctctgtttctc |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
7279143 |
caactccactttcatcttcaacatcttgttcaaactcttcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaattggctttgtttctc |
7279242 |
T |
 |
| Q |
194 |
tctg |
197 |
Q |
| |
|
|||| |
|
|
| T |
7279243 |
tctg |
7279246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 94 - 197
Target Start/End: Complemental strand, 7374696 - 7374593
Alignment:
| Q |
94 |
caactccactttcatcttcaaaatcttgttcaaactcgtcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaatcggctctgtttctc |
193 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
7374696 |
caactctaccttcatcttcaacatcttgttcaaactcttcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaattggctttgtttctc |
7374597 |
T |
 |
| Q |
194 |
tctg |
197 |
Q |
| |
|
|||| |
|
|
| T |
7374596 |
tctg |
7374593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 97 - 197
Target Start/End: Complemental strand, 5848103 - 5848003
Alignment:
| Q |
97 |
ctccactttcatcttcaaaatcttgttcaaactcgtcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaatcggctctgtttctctct |
196 |
Q |
| |
|
|||||| || |||||||| ||||| ||||||||| ||||||||||||| |||||||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
5848103 |
ctccaccttgatcttcaacatcttcttcaaactcttcctcacaagaaaacctcttgcaaacttctcaatcttcattgctgagtcggctctgtttctctct |
5848004 |
T |
 |
| Q |
197 |
g |
197 |
Q |
| |
|
| |
|
|
| T |
5848003 |
g |
5848003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University