View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18719_low_23 (Length: 205)
Name: NF18719_low_23
Description: NF18719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18719_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 41656338 - 41656163
Alignment:
| Q |
19 |
ggtattggtcaggtatttggaggttaaaggttccgccaaaggttagaaatttaatttggcaagtatgtagaggagttctgtggactcgtatacgactgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656338 |
ggtattggtcaggtatttggaggttaaaggttccgccaaaggttagaaatttaatttggcaagtatgtagaggagttctgtggactcgtatacgactgct |
41656239 |
T |
|
| Q |
119 |
tgataaaggagtgcaatgcccaactaattgtgtcagctgcgactccgccaatgaagatttatcgcacctttgcttc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656238 |
tgataaaggagtgcaatgcccaactaattgtgtcagctgcgactccgccaatgaagatttatcgcacctttgcttc |
41656163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University