View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1871_low_26 (Length: 231)

Name: NF1871_low_26
Description: NF1871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1871_low_26
NF1871_low_26
[»] chr7 (1 HSPs)
chr7 (1-212)||(33269421-33269632)
[»] chr6 (1 HSPs)
chr6 (72-211)||(10033406-10033545)
[»] chr8 (1 HSPs)
chr8 (72-193)||(35670341-35670462)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 33269632 - 33269421
Alignment:
1 ataatgaccactgtcaagctaaaaagtgaagaaaatagctaatttgaactgcattagaaattgccttaccggtgtagtgtccccttgcaaaattattagc 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
33269632 ataatggccactgtcaagctaaaaagtgaagaaaatagctaatttgaactgtattagaaattgccttaccggtgtagtgtccccttgcaaaattattagc 33269533  T
101 ggcatcttccttgccagaaattaattgctcagggtgaaaaagttgtctgtacgaaccagttcttacttcatcgattacagtgggttccagatcaacaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||    
33269532 ggcatcttccttgccagaaattaattgctcagggtgaaaaagttgtctgtaagaaccagttcttacttcatcgataacagtaggttccagatcaacaaat 33269433  T
201 aaggcccttggt 212  Q
    ||||||||||||    
33269432 aaggcccttggt 33269421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 72 - 211
Target Start/End: Original strand, 10033406 - 10033545
Alignment:
72 gtgtagtgtccccttgcaaaattattagcggcatcttccttgccagaaattaattgctcagggtgaaaaagttgtctgtacgaaccagttcttacttcat 171  Q
    ||||| ||||| ||||||||||||||||| |||||||| ||||||| |||||| || || || |||||||||||||| || | ||||| ||| | |||||    
10033406 gtgtaatgtcctcttgcaaaattattagcagcatcttctttgccagtaattaactgttctggatgaaaaagttgtctataaggaccagatctaatttcat 10033505  T
172 cgattacagtgggttccagatcaacaaataaggcccttgg 211  Q
    | |||||||| || || |||||||||||||  ||||||||    
10033506 caattacagtaggctctagatcaacaaatagagcccttgg 10033545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 193
Target Start/End: Original strand, 35670341 - 35670462
Alignment:
72 gtgtagtgtccccttgcaaaattattagcggcatcttccttgccagaaattaattgctcagggtgaaaaagttgtctgtacgaaccagttcttacttcat 171  Q
    ||||||||||| || |||||||| |||||||| ||||| ||||| || || | ||| |||||||| || ||||||| ||| | ||| |  |  |||||||    
35670341 gtgtagtgtcctctagcaaaattgttagcggcgtcttctttgccggagatgagttgttcagggtggaagagttgtcggtaggtaccggaacgaacttcat 35670440  T
172 cgattacagtgggttccagatc 193  Q
    |||| || |||||||| |||||    
35670441 cgatgacggtgggttcaagatc 35670462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University