View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1871_low_29 (Length: 211)
Name: NF1871_low_29
Description: NF1871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1871_low_29 |
 |  |
|
| [»] scaffold0272 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0272 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 6949 - 7126
Alignment:
| Q |
17 |
atcacccacctgcaactgtgcatcagaacgtcttttatcagcttgcactttgataccagttgagccttgtgcaaggtcgttttaagctgagtcaaaagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6949 |
atcacccacctgcaactgtgcatcagaacgtcttttctcagcttgcactttgataccagttgagccttgtgcaaggtcgttttaagctgagtcaaaagac |
7048 |
T |
 |
| Q |
117 |
catcctgttccaccaaacgttgttgcaagtccacatgatcagttgcataagccatataacgaactatagagggtggat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7049 |
catcctgttccaccaaacgttgttgcaagtccacaggatcagttgcataagccatataacgaactatagagggtggat |
7126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University