View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18720_high_18 (Length: 249)
Name: NF18720_high_18
Description: NF18720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18720_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 237
Target Start/End: Original strand, 46809462 - 46809689
Alignment:
| Q |
10 |
aagaatatttgcaattatgaaaacaagctttggagtattatgaactaacagacaaagaatgaaaaactgagnnnnnnnntaccattcttgatctctttaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46809462 |
aagaatatttgcaattatgaaaacaagctttggagtattatgaactaacagacaaagaatgaaaaactgagaaaaaaaataccattcttgatctctttaa |
46809561 |
T |
 |
| Q |
110 |
gcttccattcgcgagcacttttaatgtctttagctaagccaagaggatttagcagaggacccccagggtacctatttgttgaaacgagattatatacctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46809562 |
gcttccattcgcgagcacttttaatgtctttagctaagccaagaggatttagcagaggacccccagggtacctatttgttgaaacaagattatatacctt |
46809661 |
T |
 |
| Q |
210 |
aactagcttacaattgtgaataacgaag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
46809662 |
aactagcttacaattgtgaataacgaag |
46809689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University