View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18720_low_15 (Length: 341)
Name: NF18720_low_15
Description: NF18720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18720_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 25 - 336
Target Start/End: Complemental strand, 4627005 - 4626694
Alignment:
| Q |
25 |
tgtttaaatcactttatgtatgtctttaatttgtataatcaaacttcaaactcacaattggcctaatttttgtattgtttaatttttattagatgccctc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4627005 |
tgtttaaatcactttatgtatgtctttaatttgtataatcaaacttcaaactcacaattggcctaatttttgtattgtttaatttttattagatgccctc |
4626906 |
T |
 |
| Q |
125 |
tggttcatctagtcaatttggagtgcctccacatgaaggtgacaggcagatggtggtattttctggacctcagctttcgaacatgatggtttctactgat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626905 |
tggttcatctagtcaatttggagtgcctccacatgaaggtgacaggcagatggtggtattttctggacctcagctttcgaacatgatggtttctactgat |
4626806 |
T |
 |
| Q |
225 |
gtgtatgctaatgatattactgttgttcctcgttctgggtaagttgccaggcctatgtaagttgaaaggcagccttttgttttccatgttttcacatttc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626805 |
gtgtatgctaatgatattactgttgttcctcgttctgggtaagttgccaggcctatgtaagttgaaaggcagccttttgttttccatgttttcacatttc |
4626706 |
T |
 |
| Q |
325 |
tgcgttgttttt |
336 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4626705 |
tgcgttgttttt |
4626694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University