View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18721_low_11 (Length: 314)
Name: NF18721_low_11
Description: NF18721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18721_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 305
Target Start/End: Original strand, 45615820 - 45616112
Alignment:
| Q |
16 |
tgttcaactcttttatgcatatacaatgtcttcacaaatgccataattatttatggtgatataaaagaacccgtggctactctttatttatgccgctctg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45615820 |
tgttcaactcttttatgcatatacaatgtcttcacaaatgccataattatttatggtcatataaaagaacctgtggctactctttatttatgccgctctg |
45615919 |
T |
|
| Q |
116 |
gaatttggactaatagaa--gattataaatcataagtagggtccatctaagaatatagctaggttcaaagtaggatactagcttgcccttttagaaatag |
213 |
Q |
| |
|
|||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45615920 |
gaatttggactaatagcacagattataagccataagtagggtccatctaagaatatagctaggttcaaagtaggataccagcttgcccttttagaaatag |
45616019 |
T |
|
| Q |
214 |
aattttggaaaagaaatcattagagaaaatgggtggttaagacatcagtcaaaaataagata-ttaaatcatagactaaacaataagaataat |
305 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
45616020 |
aatttttgaaaagaaatcattagagaaaatggttggttaagtcatcagtcaaaaataagatacttaaatcatagactaaacattaagagtaat |
45616112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University