View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18721_low_13 (Length: 267)
Name: NF18721_low_13
Description: NF18721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18721_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 40 - 257
Target Start/End: Complemental strand, 30822837 - 30822617
Alignment:
| Q |
40 |
aaaatatatattatttttaaataaaaatacactcctttgcaataacgtcaatcttttgaaattgcactcttcaattactattat---aagtaagagtgtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30822837 |
aaaatatatattatttttaaataaaaatacactcctttgtaataacgtcaatcttttgaaattgcactcttcaattactattattataagtaagagtgtt |
30822738 |
T |
 |
| Q |
137 |
gctatatctagcaaaaattaatttcgcatcatttcatgaacatgcaatactgtgggtttatgaaggaaagagcataacaagtgatgctatcaagttccat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30822737 |
gctatatctagcaaaaattaatttcgcataatttcatgaacatgcaatactgtgggtttatgaaggaaagagcataacaagtgatgttatcaagttccat |
30822638 |
T |
 |
| Q |
237 |
attttatgtaaattaggcggt |
257 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
30822637 |
attttatgtaaatcaggcggt |
30822617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University