View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18721_low_15 (Length: 244)
Name: NF18721_low_15
Description: NF18721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18721_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 38 - 228
Target Start/End: Complemental strand, 48002766 - 48002579
Alignment:
| Q |
38 |
tttggttgcaagttgaaattctctctaaacttgcggtgcaaaggtaaaagtgatttaacttggttaaaatgtgtgtttggatttcattttagaaatcgat |
137 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48002766 |
tttggttgcaagttgaaattctct--aaacttgcggtgcaaaggtaaaagtgatttaacttggctaaaatgtgtgtttggatttcattttagaaatcgat |
48002669 |
T |
 |
| Q |
138 |
ttcaatagaagctacaaatagtagtttttgcggccaattaaatcgattttgttatgatttattgtcctcttacctaactacccttacactt |
228 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
48002668 |
ttcaatagaagcta-aaatagtagtttttgcggccaattaaatcgattttgttatgacttattgtcctcttacctaactacccttatactt |
48002579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University