View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18721_low_15 (Length: 244)

Name: NF18721_low_15
Description: NF18721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18721_low_15
NF18721_low_15
[»] chr1 (1 HSPs)
chr1 (38-228)||(48002579-48002766)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 38 - 228
Target Start/End: Complemental strand, 48002766 - 48002579
Alignment:
38 tttggttgcaagttgaaattctctctaaacttgcggtgcaaaggtaaaagtgatttaacttggttaaaatgtgtgtttggatttcattttagaaatcgat 137  Q
    ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
48002766 tttggttgcaagttgaaattctct--aaacttgcggtgcaaaggtaaaagtgatttaacttggctaaaatgtgtgtttggatttcattttagaaatcgat 48002669  T
138 ttcaatagaagctacaaatagtagtttttgcggccaattaaatcgattttgttatgatttattgtcctcttacctaactacccttacactt 228  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||    
48002668 ttcaatagaagcta-aaatagtagtttttgcggccaattaaatcgattttgttatgacttattgtcctcttacctaactacccttatactt 48002579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University