View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18721_low_17 (Length: 240)
Name: NF18721_low_17
Description: NF18721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18721_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 24 - 224
Target Start/End: Original strand, 28252171 - 28252375
Alignment:
| Q |
24 |
tgattgatcagaatttggagagagttctgtcacccaaaagaggtagatgtaccg----acattcatattaattcaaaattgcaatcacttcaaattaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28252171 |
tgattgatcagaatttggagagagttctgtcacccaaaaaaggtagatgtaccgaccgacattcatattaattcaaaattgcaatcacttcaaattaatt |
28252270 |
T |
|
| Q |
120 |
aaatgaatatatatatttttactaaatgnnnnnnngactcaaattaaatgattaaatatacctaatatccaatcatttcatttgtcatcacattaatcta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28252271 |
aaatgaatatatatatttttactaaatgttttttttactcaaattaaatgattaaatatacctaatatccaatcatttcatttgtcatcacattaatcta |
28252370 |
T |
|
| Q |
220 |
atttt |
224 |
Q |
| |
|
||||| |
|
|
| T |
28252371 |
atttt |
28252375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University