View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18722_high_3 (Length: 460)
Name: NF18722_high_3
Description: NF18722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18722_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 114 - 442
Target Start/End: Complemental strand, 50492560 - 50492245
Alignment:
| Q |
114 |
ggggagaagagcagttttcaagctgcaaagcccaagaacacatgcttctatnnnnnnnnnggccaatgatttggcgcaacctggaccgggtatcggaagc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50492560 |
ggggagaagagcagttttcaagctgcaaagcccaagaacacatgcttctat-------------aatgatttggcgcaacctggaccgggtatcggaagc |
50492474 |
T |
|
| Q |
214 |
acgctccggcccaacaatagaattggcgccaatgttttcgcgccaaaatcagtgaaccccaccagcacccattgataaaccctcggaagttgcaacccta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50492473 |
acgctccggcccaacaatagaattggcgccaatgttttcgcgccaaaatcagtgaaccccaccagcacccattgataacccctcggaagttgcaacccta |
50492374 |
T |
|
| Q |
314 |
aacacacaatcgaattcttcagagcaaaactgaaattgaaacacttcagagctagaagagaagaagcgaagaatcatggatccagaaaatcctgcatcaa |
413 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50492373 |
aacacacaatcgaattattcagagcgaaactgaaattgaaacacttcagagctagaagagaagaagtgaagaatcatggatccagaaaatcctgcatcaa |
50492274 |
T |
|
| Q |
414 |
ctcccgattcaccaacctcaccatccgcc |
442 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
50492273 |
ctcccgattcaccaacttcaccatccgcc |
50492245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 41900292 - 41900372
Alignment:
| Q |
19 |
ggagacatgtcgacatatggggttgatggggaaggagaggggggtggcggagatttgtagagatgtggtggaggaagtgaa |
99 |
Q |
| |
|
|||||| ||| ||||||||| | || ||| ||||||||||| ||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
41900292 |
ggagacttgtagacatatggaggtggtggtgaaggagagggaggtggaggagatttgtagacatatggtggaggaagtgaa |
41900372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University