View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18722_low_5 (Length: 305)
Name: NF18722_low_5
Description: NF18722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18722_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 187 - 273
Target Start/End: Original strand, 33570723 - 33570809
Alignment:
| Q |
187 |
ggttcatgactaggatatttagttttcaaggtacaccgacatttgttcaatttgttataagtatagcactgcatttgcttgttttac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
33570723 |
ggttcatgactaggatatttagttttcaaggtacaccgacatttgttcaatttgtaataagtatagcactgaatctgcttgttttac |
33570809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 76 - 151
Target Start/End: Original strand, 23481642 - 23481717
Alignment:
| Q |
76 |
cttcttctgagcaatgtaaaactaatgtattggtcttggataattgataatgaaaatgtgacgtggcagtggtatg |
151 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23481642 |
cttcttctgaggaatttaaaactaatgtattggtcttggataattgataatgaaaatgtgacgtggcagtggtatg |
23481717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 23481573 - 23481610
Alignment:
| Q |
19 |
aaaagggatgattgaattgatgttgcgacatgctctga |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23481573 |
aaaagggatgattgaattgatgttgcgacatgctctga |
23481610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 106 - 143
Target Start/End: Original strand, 23473188 - 23473225
Alignment:
| Q |
106 |
tggtcttggataattgataatgaaaatgtgacgtggca |
143 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
23473188 |
tggttttggataatggataatgaaaatgtgacgtggca |
23473225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University