View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18722_low_6 (Length: 296)
Name: NF18722_low_6
Description: NF18722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18722_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 37181039 - 37180780
Alignment:
| Q |
18 |
tctttcgccaccgttgtcgcatcggcatgaaggtatgtaactcttttactttgtgtagttatgacatttagatatgacaaattttttattgtaggttctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37181039 |
tctttcgccaccgttgtcgcatcggcatgaaggtatgtaagtcttttactttgtgtagttatgacatttagatatgacaaattttttattgtaggttctt |
37180940 |
T |
|
| Q |
118 |
taa-caatgtctttagaacacttgtcaacaggatcctaactttagtttcatccccgaagaattctataatgatttaaaatggcatatgaggatatacact |
216 |
Q |
| |
|
||| |||||| ||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37180939 |
taaacaatgttcttagaacacttatcaacaggatcctaactttagtttcatctccgaaaaattctatactgatttaaaatggcatatgaggatatacact |
37180840 |
T |
|
| Q |
217 |
tgacataatatgattggatgaggataatggacaaagtcgaaatggttgccatgttgagaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37180839 |
tgacataatatgattggatgaggataatggacaaagtcgaaatggttgccatgttgagaa |
37180780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University