View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18723_high_10 (Length: 252)
Name: NF18723_high_10
Description: NF18723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18723_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 74 - 235
Target Start/End: Complemental strand, 50658883 - 50658722
Alignment:
| Q |
74 |
tagagggtcaatgtttaataaaaacagcaagccaataactaatatttctccaccatatgttggtttctttgatcccgcgtttttgaaagccgatgcatgg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50658883 |
tagagggtcaatgtttaataaaaacagcaagccaataactaatatttctccaccttatgttggtttctttgatcctgcgtttttgaaagccgatgcatgg |
50658784 |
T |
|
| Q |
174 |
catccaaagaaaccaagcggatggctgtgactttggtgtttgaagagatggtggaggttgct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50658783 |
catccaaagaaaccaagcggatggctgtgactttggtgtttgaagagatggtggaggttgct |
50658722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 96
Target Start/End: Complemental strand, 50659015 - 50658987
Alignment:
| Q |
68 |
agaatctagagggtcaatgtttaataaaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50659015 |
agaatctagagggtcaatgtttaataaaa |
50658987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University