View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18723_low_12 (Length: 250)
Name: NF18723_low_12
Description: NF18723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18723_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 42306629 - 42306388
Alignment:
| Q |
9 |
gaagaatattcactaaattctctatattattannnnnnnnnctaattttctcaataaaattttcataattgagtcactgcacagttaatatttcttccac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306629 |
gaagaatattcactaaattctctatattattatttttttt-ctaattttctcaataaaattttcataattgagtcactgcacagttaatatttcttccac |
42306531 |
T |
|
| Q |
109 |
atttctttctcatatcttgaagaatctggctgaaaagtatgatagtttaggagcgttcagaaccgcagtagccgagtaacgcaagatggattagaatctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306530 |
atttctttctcatatcttgaagaatctggctgaagagtatgatagtttaggagcgttcagaaccgcagtagccgagtaacgcaagatggattagaatctt |
42306431 |
T |
|
| Q |
209 |
caggttgtagcttctg-tgctggtcaaaatcaatacagtttca |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42306430 |
caggttgtagcttctgttgctggtcaaaatcaatacagtttca |
42306388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University