View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18723_low_13 (Length: 247)
Name: NF18723_low_13
Description: NF18723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18723_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 44869265 - 44869481
Alignment:
| Q |
1 |
tgattttaaattgcggttgtggttaggttgagaaacttttaattgcagtaaaatataggaaaatgtggcgtgccgtcaaaattgtggccgtaatatgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44869265 |
tgattttaaattgcggttgtggttaggttgagaaacttttaattgcggtaaaatataggaaaatgtggcgtgccgtcaaaattgtggccgtgatatgcct |
44869364 |
T |
|
| Q |
101 |
ttcctgagatctcaaaaccctttatgtctgcaaactgcaatttaaaaccatgtatgaatgtataaaatcaatttcatttaaaaattattttagtcccagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44869365 |
ttcctgagatctcaaaaccctttatgtctgcaaactgcaatttaaaaccatgtatgaacatataaaatcaatttcatttaaaaattattttagtcccaat |
44869464 |
T |
|
| Q |
201 |
ggttttattgtttttca |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44869465 |
ggttttattgtttttca |
44869481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University