View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18723_low_18 (Length: 231)
Name: NF18723_low_18
Description: NF18723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18723_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 14 - 166
Target Start/End: Complemental strand, 24079280 - 24079131
Alignment:
| Q |
14 |
aacctgtgtaagtatttcatgtcaaatgacacttattcatctgaatcaactgtatgatgcaataataatacggaaaaagtgttgaaactaagcatcttgt |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24079280 |
aacctatgtaagtatttcatgtcaaatgacacttattcatctgaatcaactgtatgatgcaataata---cggaaaaagtgttgaaactaagcatcttgt |
24079184 |
T |
 |
| Q |
114 |
tagaacttaaacctgcattgattctaccacttccatgtattacattgttttgt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24079183 |
tagaacttaaacctgcattgattctaccacttccatgtattacattgttttgt |
24079131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 24079116 - 24079057
Alignment:
| Q |
158 |
ttgttttgtattcataccttattctctcatta-tctttatattatatgatatctgattca |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24079116 |
ttgttttgtattcatactttattctctcattaatctttatattatatgatatctgattca |
24079057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 78
Target Start/End: Original strand, 7893672 - 7893714
Alignment:
| Q |
36 |
caaatgacacttattcatctgaatcaactgtatgatgcaataa |
78 |
Q |
| |
|
|||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
7893672 |
caaatgccacttattcatgtcaatcaactgtatgatgcaataa |
7893714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University