View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18724_high_16 (Length: 237)
Name: NF18724_high_16
Description: NF18724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18724_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 43574222 - 43574422
Alignment:
| Q |
19 |
tatatagcccaaatattcacaaatgtttctctagtttgttcacatgatatttactttttgactgttcctttaccttgtctttgcacttcgcgaacccact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43574222 |
tatatagcccaaatattcacaaatgtttctctagtttgttcacatgatatttactttttgactgttccgttaccttgtctttgcacttcgcgaacccact |
43574321 |
T |
|
| Q |
119 |
tctttgcccgtacaaaagaatcctgagaaagaaaatgcaccatttatttcttctgatatgatattttttagatgaaaatatttgtagcacagatgcaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43574322 |
tctttgcccgtacaaaagaatcctgagaaagaaaatgcaccatttatttcttctgatatgatattttttagatgaaaatatttgtagcacggatgcaata |
43574421 |
T |
|
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
43574422 |
a |
43574422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University