View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18724_high_18 (Length: 225)

Name: NF18724_high_18
Description: NF18724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18724_high_18
NF18724_high_18
[»] chr8 (1 HSPs)
chr8 (19-213)||(29606954-29607160)


Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 29607160 - 29606954
Alignment:
19 gaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29607160 gaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctg 29607061  T
119 gcgcatcatcttcaggcgatggtgct------------ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacagg 206  Q
    ||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29607060 gcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacagg 29606961  T
207 tgatgat 213  Q
    |||||||    
29606960 tgatgat 29606954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University