View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18724_low_19 (Length: 225)
Name: NF18724_low_19
Description: NF18724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18724_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 29607160 - 29606954
Alignment:
| Q |
19 |
gaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607160 |
gaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctg |
29607061 |
T |
 |
| Q |
119 |
gcgcatcatcttcaggcgatggtgct------------ggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607060 |
gcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgtctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacagg |
29606961 |
T |
 |
| Q |
207 |
tgatgat |
213 |
Q |
| |
|
||||||| |
|
|
| T |
29606960 |
tgatgat |
29606954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University