View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18726_low_1 (Length: 333)
Name: NF18726_low_1
Description: NF18726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18726_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 26798341 - 26798653
Alignment:
| Q |
1 |
aggtaagctgcgtgattccatgtcaagagaatcgcgtttttgggttgaaaaatgagaatgatcataaactcgattgtcatgatgattatgctctgtgttg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26798341 |
aggtaaactgcgtgattccatgtcaagagaatcacgtttttgggttgaaaaatgagaatgatcataaactcgattgtcatgatgattatgctccgtgttg |
26798440 |
T |
|
| Q |
101 |
ttatcatcctcctcttttatcactactttaggttcagaagacattttgatgagttacgttggnnnnnnnggctatacacacactacaagaagtttgtcat |
200 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26798441 |
ttatcttcctcctcttttatcacaactttaggttcagaagacattttgatgagttacgttgg-ttttttggctatacacacactacaagaagtttgtcat |
26798539 |
T |
|
| Q |
201 |
atagtaatagagacctttagtgaccgc--nnnnnnngtgttggtatggattaaatatagcaagtgaaatttcatt-aggcgtttctgtagggtgggagga |
297 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26798540 |
atagtaatagagacctttagtgaccgcaaaaaaaaagtgctggtatagattaaatatagcaagtgaaatttcattcaggcgtttctgtagggtgggagga |
26798639 |
T |
|
| Q |
298 |
caaaaatgcaccaca |
312 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
26798640 |
c-aaaatgcaccaca |
26798653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University