View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18726_low_2 (Length: 315)
Name: NF18726_low_2
Description: NF18726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18726_low_2 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0010 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 303
Target Start/End: Complemental strand, 252965 - 252680
Alignment:
| Q |
18 |
gttcctttatatgttacattaaatcaaaggcttccattctttgataacattatggatttgattcatacaactgggtttatggatggttggattgatctgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252965 |
gttcctttatatgttacattaaatcaaaggcttccattctttgataacattatggatttgattcatacaactgggtttatggatggttggattgatctgc |
252866 |
T |
|
| Q |
118 |
tattattggatttcatattgtatgattgggatagaattttaagaccaggagggttactatggattgacaagttcttttgtaaaagaaaggatttagatga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
252865 |
tattattggatttcatattgtatgattgggatagaattttaagaccaggagggttactatggattgataggttcttttgtaaaagaaaggatttagatga |
252766 |
T |
|
| Q |
218 |
ttatatgtacatgtttcttcaactaaggtacaagaaacacaagtgggttatttctccaaagtcaaaggatgaaatatatctctctg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252765 |
ttatatgtacatgtttcttcaactaaggtacaagaaacacaagtgggttatttctccaaagtcaaaggatgaaatatatctctctg |
252680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 37 - 184
Target Start/End: Complemental strand, 10803729 - 10803582
Alignment:
| Q |
37 |
taaatcaaaggcttccattctttgataacattatggatttgattcatacaactgggtttatggatggttggattgatctgctattattggatttcatatt |
136 |
Q |
| |
|
||||||||||||||||||| ||||| || | | ||||||||||| ||||| ||||| | ||||||||||| ||| | | | |||||||| | || |
|
|
| T |
10803729 |
taaatcaaaggcttccattttttgacaatacacttgatttgattcacacaacaaggtttcttgatggttggatagattttgtgcttttggattttgtttt |
10803630 |
T |
|
| Q |
137 |
gtatgattgggatagaattttaagaccaggagggttactatggattga |
184 |
Q |
| |
|
|||||||||||||||| |||| || ||||| ||||| || |||||||| |
|
|
| T |
10803629 |
gtatgattgggatagagttttgaggccaggtgggttgctttggattga |
10803582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University