View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18727_high_19 (Length: 313)

Name: NF18727_high_19
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18727_high_19
NF18727_high_19
[»] chr1 (3 HSPs)
chr1 (107-202)||(1865473-1865567)
chr1 (15-58)||(1865380-1865423)
chr1 (232-283)||(1865610-1865661)


Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 107 - 202
Target Start/End: Original strand, 1865473 - 1865567
Alignment:
107 agaaattgcttagcgaaagcaaagatttgnnnnnnngtgaaaatccatgttagtctatgggaaaatttagcaagactcaatttacgtcctgagaaa 202  Q
    |||||||||||||| ||||||||||| ||       |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
1865473 agaaattgcttagcaaaagcaaagatatgtttttt-gtgaaaatccatgttagtctatgggaaaatttagcaagactcaatttatgtcctgagaaa 1865567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 1865380 - 1865423
Alignment:
15 tatgaacttggtattttgaacatgactctgaatggaaaatgata 58  Q
    |||| ||||||||||||||||||||||||||| |||||||||||    
1865380 tatggacttggtattttgaacatgactctgaaaggaaaatgata 1865423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 283
Target Start/End: Original strand, 1865610 - 1865661
Alignment:
232 agtccatgttatccttttcttttttaccgaacggagatgtggataatttcaa 283  Q
    |||| |||||||| |||||||||||||||||| ||| |||||||||||||||    
1865610 agtcgatgttatctttttcttttttaccgaacagagctgtggataatttcaa 1865661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University