View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_high_19 (Length: 313)
Name: NF18727_high_19
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 107 - 202
Target Start/End: Original strand, 1865473 - 1865567
Alignment:
| Q |
107 |
agaaattgcttagcgaaagcaaagatttgnnnnnnngtgaaaatccatgttagtctatgggaaaatttagcaagactcaatttacgtcctgagaaa |
202 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1865473 |
agaaattgcttagcaaaagcaaagatatgtttttt-gtgaaaatccatgttagtctatgggaaaatttagcaagactcaatttatgtcctgagaaa |
1865567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 1865380 - 1865423
Alignment:
| Q |
15 |
tatgaacttggtattttgaacatgactctgaatggaaaatgata |
58 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1865380 |
tatggacttggtattttgaacatgactctgaaaggaaaatgata |
1865423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 283
Target Start/End: Original strand, 1865610 - 1865661
Alignment:
| Q |
232 |
agtccatgttatccttttcttttttaccgaacggagatgtggataatttcaa |
283 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1865610 |
agtcgatgttatctttttcttttttaccgaacagagctgtggataatttcaa |
1865661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University