View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_high_21 (Length: 301)
Name: NF18727_high_21
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_high_21 |
 | |
|
| [»] scaffold0219 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 11313 - 11456
Alignment:
| Q |
17 |
ttgtgagatcgaggcaaaacgtgaaaagggtcatatcccttcaggcgattcgcaattcctaaaatgtgttcttgcgtctaaatctcttgacattgctcct |
116 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313 |
ttgtgagaccgaggcaaaaggtgaaaagggtcatatcccttcaggcgattcgcaattcctaaaatgtgttcttgcgtctaaatctcttgacattgctcct |
11412 |
T |
|
| Q |
117 |
tgggacattcacaatagatgaaacatgaccctctattatgcact |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11413 |
tgggacattcacaatagatgaaacatgaccctctattatgcact |
11456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 222 - 285
Target Start/End: Original strand, 11518 - 11581
Alignment:
| Q |
222 |
ttgctattcgtctaggttaacttcatacttttcatcatagattattttacaatgcatatagaac |
285 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11518 |
ttgctattcgtctagggtaacttcatacttttcatcatagattattttacaatgcatatagaac |
11581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University