View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_high_27 (Length: 280)
Name: NF18727_high_27
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 263
Target Start/End: Original strand, 44238507 - 44238771
Alignment:
| Q |
15 |
cttgtattttacgtcttccattttcgaaaaagaataatagatctgaaattaatcgattttggggttgaaatcgtcgaaagaagtgattgtttgttttatg |
114 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44238507 |
cttgtcttttacgtcgtccattttcggaaaagaataatagatctgaaattaatcgattttggggttgaaatcgtcgaaagaagtgattgtttgttttatg |
44238606 |
T |
 |
| Q |
115 |
gaaggaaggaagaaacaaacactcacggaatagatgtaagcggatagagagggggtttgttgacttgacttcataaaattcacctttttataa------- |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44238607 |
gaaggaaggaagaaacaaacacgcacggaatagatgtaagcggatagagagggggtttgttgacttgacttcataaaattcacctttttctaataatcaa |
44238706 |
T |
 |
| Q |
208 |
---------ccaataaggttttgccacttcatcatactcaagaaactttaaggcatgcgccattt |
263 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44238707 |
aatgtgtctccaataaggctttgccacttcatcatactcaagaaactttaaggcatgcgccattt |
44238771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University