View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_high_32 (Length: 265)
Name: NF18727_high_32
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 57 - 247
Target Start/End: Original strand, 5982698 - 5982888
Alignment:
| Q |
57 |
tacagcgcatgcttcataaaactcttatcacatcgtaaagtatatgcatgctggcctcctctacgtacgtcaaattaaaggacactagcctttaattcac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5982698 |
tacagcgcatgcttcataaaactcttatcacatcgtaaagtatatgcatgctggcctcctctacgtacgtcaaattaaagtacactagcctttaattcac |
5982797 |
T |
|
| Q |
157 |
caggatgtagtatacggcttttgtctttgttaacaatcatagtagctctccataaatagcatccacatatagttttgtgtgacgaacatac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
5982798 |
caggatgtagtatacggcttttgtctttgttaacaatcatagtagctctccataaataacatccacatatagttttttgtgacgaacatac |
5982888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 100 - 166
Target Start/End: Original strand, 5947065 - 5947131
Alignment:
| Q |
100 |
atgcatgctggcctcctctacgtacgtcaaattaaaggacactagcctttaattcaccaggatgtag |
166 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| || | ||||||| |
|
|
| T |
5947065 |
atgcatgctggcctcctctacctaggtcaaattaaaggacactagcctttaattgacaaagatgtag |
5947131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 247
Target Start/End: Original strand, 5958356 - 5958405
Alignment:
| Q |
198 |
gtagctctccataaatagcatccacatatagttttgtgtgacgaacatac |
247 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| || ||||||||||| |
|
|
| T |
5958356 |
gtagctctccataaataacatccatatatagttttatgcgacgaacatac |
5958405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University