View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_high_43 (Length: 238)
Name: NF18727_high_43
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 36324135 - 36324345
Alignment:
| Q |
10 |
agaagcaaagggaaccacaagcaggcagtacttggcgggaaacaacaccagataccgtagtcattttcaaattcaagcaacatcaaccaattgattagtt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36324135 |
agaaacaaagggaaccacaagcaggcagtacttggcgggaaacaacaccagataccgtagtcattttcaaattcaagcaacatcaaccaattgattagtt |
36324234 |
T |
 |
| Q |
110 |
ttgaggaaattcaaaaaatctggcttgaaattcttctctctttcccttcttgcatgcaccaatcagaaaaatccgacactgaacgtgaagaagggaaaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36324235 |
ttgaggaaattcaaaaaatctggcttgaaattcttctctctttcccttcttgcatggatcaatcagaaaaatccgacactgaacgtgaagaagggaaaga |
36324334 |
T |
 |
| Q |
210 |
aaggccaaaac |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
36324335 |
aaggccaaaac |
36324345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University