View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_high_47 (Length: 236)
Name: NF18727_high_47
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_high_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 236
Target Start/End: Complemental strand, 13388182 - 13387962
Alignment:
| Q |
15 |
acatacatattccaccagtaataaactttttacaagtgattccttttgcaccccattaacttttctgctatccaacacatattctcattgcgtgtgacgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
13388182 |
acatacatattccaccagtaataaactttttacaagtgattccttttgcaccccattaacttctctgctatccaacacatattctcattgcgtgtgatgt |
13388083 |
T |
 |
| Q |
115 |
atgtaagtggaaaattgtctcttaaaaaccaccttaaaagcctgacaccttacaccttttttcttcaacatcttggcatatatatgttacaaaaccaaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13388082 |
atgtaagtggaaaattgtctcttaaaaaccaccttaaaagcctgacaccttaccccttttttcttcaacatcttggcatatatatgttacaaaacc-aaa |
13387984 |
T |
 |
| Q |
215 |
gcatggcttcagaaaaagcctc |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13387983 |
gcatggcttcagaaaaagcctc |
13387962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University