View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_low_29 (Length: 282)
Name: NF18727_low_29
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 75 - 267
Target Start/End: Complemental strand, 28209132 - 28208942
Alignment:
| Q |
75 |
accataatgtagtgcagattataagctctgaaatgacaaatttcaggtgtgtaagtgacaaggacataatagcaaaaggtgcatatgtaggattagcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209132 |
accataatgtagtgcagattataagctctgaaatgacaaatttcaggtgtgtaagtgacaaggacataatagcaaaaggtgcatatgtaggattagcccc |
28209033 |
T |
|
| Q |
175 |
accaggagatgctggatcttggcaaagggaatgcaaggtttgttgccaaatatatatagatttttcacacccttgaatataactttcaaatgt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28209032 |
accaggagatgctggatcttggcaaagggaatgcaaggtttgtagccaaatatatat--atttttcacacccttgaatataactttcaaatgt |
28208942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 28209230 - 28209166
Alignment:
| Q |
1 |
aaagtttcaaactcttaggattgatcaaagtagaatattaaaatgttgctttaaagttttaatac |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209230 |
aaagtttcaaactcttaggattgatcaaagtagaatattaaaatgttgctttaaagttttaatac |
28209166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 152 - 213
Target Start/End: Complemental strand, 52048382 - 52048321
Alignment:
| Q |
152 |
ggtgcatatgtaggattagccccaccaggagatgctggatcttggcaaagggaatgcaaggt |
213 |
Q |
| |
|
||||| ||||| |||||||| | |||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
52048382 |
ggtgcttatgtgggattagcagccccaggagatgttggatcttggcaaagagaatacaaggt |
52048321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University