View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_low_53 (Length: 232)
Name: NF18727_low_53
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 13262451 - 13262235
Alignment:
| Q |
1 |
cccgccgttgatgcgattcagaagctcatcgcgcatggatttcttcgcggtgaagctgatcccggtggtagttccagtgaagcgaaattgctttcgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13262451 |
cccgccgttgatgcgattcagaagctcatcgcgcatggatttcttcgcggtgaagctgatcccggtggtagttccagtgaagcgaaattgctttcgaaaa |
13262352 |
T |
|
| Q |
101 |
tgattgaatcggtttgtaaatgtcatgatttcggtgatgatgcgatggaattgcttgttttgaagacgttgttatctgctgtgacttcgatttcgcttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13262351 |
tgattgaatcggtttgtaaatgtcatgatttcggtgatgatgcgatggaattgcttgttttgaagactttgttatctgctgtgacttcgatttcgcttcg |
13262252 |
T |
|
| Q |
201 |
aattcacggtgattgtt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13262251 |
aattcacggtgattgtt |
13262235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 101 - 217
Target Start/End: Original strand, 28133777 - 28133893
Alignment:
| Q |
101 |
tgattgaatcggtttgtaaatgtcatgatttcggtgatgatgcgatggaattgcttgttttgaagacgttgttatctgctgtgacttcgatttcgcttcg |
200 |
Q |
| |
|
||||||||||||| ||||||||||| || | ||||||||||| ||||| | | || ||||||||| | |||||||| || ||||||||||| ||||| |
|
|
| T |
28133777 |
tgattgaatcggtgtgtaaatgtcacgacctaggtgatgatgctatggagcttttggtgttgaagacgcttttatctgcggtaacttcgatttcacttcg |
28133876 |
T |
|
| Q |
201 |
aattcacggtgattgtt |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28133877 |
gattcacggtgattgtt |
28133893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University