View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_low_54 (Length: 229)
Name: NF18727_low_54
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 224
Target Start/End: Original strand, 31034691 - 31034909
Alignment:
| Q |
3 |
aatacctagagaaagactccatgatcctaccaccaaaacccttctgaggtccacaatggatgaaaatgaaaaaacaaagaaacccttgccattaggtgta |
102 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31034691 |
aatacctagagaaagactcaatgatcctaccaccaaaacccttctaagggctacaatggatgaaaatgaaaaaacaaagaaacccttgccattaggtgta |
31034790 |
T |
 |
| Q |
103 |
agagactatttgccaagaacatttcaatttcaaagagcgtttaactttgtgtgcaggttaccatttgttggagaag---attcccatttcgttaatataa |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31034791 |
agagactatttgccaagaac------atttcaaagagcgtttaactttgtgtgcagggaaccatttgttggagaagatcattcccatttcgttaatataa |
31034884 |
T |
 |
| Q |
200 |
ttcttccatggaggaaattttcgca |
224 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
31034885 |
ttcttccacggaggaaattttcgca |
31034909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University