View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_low_57 (Length: 214)
Name: NF18727_low_57
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 16598942 - 16598755
Alignment:
| Q |
13 |
aatatattatggggacgtagtttgttgaacggagtaaaagtgtatgatagtgtatcttgaaatacatgcgcgtgagaataagatctgtaacccatt--at |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16598942 |
aatatattatggggacgtagtttgttgaacggagtaaaagtgtatgatagtgtatcttgaaatacatgcgcgtgagaataagatctgtaacccattatat |
16598843 |
T |
 |
| Q |
111 |
atgttaatcagtttaactctgaaaaggtgaaaaatacatcttatattgttaatgtgacacgtttatgaataatatgatcaaagctttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16598842 |
atgttaatcagtttaactctgaaaaggtgaaaaatacatcttatattgttaatgtgacacgtttatgaataatatgatcaaagctttt |
16598755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University