View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18727_low_9 (Length: 429)
Name: NF18727_low_9
Description: NF18727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18727_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 47 - 332
Target Start/End: Complemental strand, 47534949 - 47534664
Alignment:
| Q |
47 |
tgttggaatattcttgagaagaatcatgttggtgatgaaaaactcaagaaggttcaattacaaacactgaagaggcagtttgagttgttgctggtggaac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534949 |
tgttggaatattcttgagaagaatcatgttggtgatgaaaaactcaagaaggttcaattacaaacactgaagaggcagtttgagttgttgctggtggaac |
47534850 |
T |
|
| Q |
147 |
caagtgagaacattgcagagaatttcaactaagttacttgcgatgatgaagtatttgatcaaacaattatgaacaaggttatgcacattatatcaacttg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47534849 |
caagtgagaacattgcagagaatttcaacaaagttacttgcgatgatgaagtatttgatcaaacaattatgaacagggttatgcacattatatcaacttg |
47534750 |
T |
|
| Q |
247 |
actgtatttaagttgctatagaggaatccaaagatttatccaacatgaaaattgaagatctgtaatgcttgttggaagcaaatgag |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534749 |
actgtatttaagttgctatagaggaatccaaagatttatccaacatgaaaattgaagatctgtaatgcttgttggaagcaaatgag |
47534664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 331 - 412
Target Start/End: Complemental strand, 47534403 - 47534322
Alignment:
| Q |
331 |
agtgatatagattatgatccaatactgctcatggcgactaaaaatagtggacttgggagcactgatggatggtacttggata |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534403 |
agtgatatagattatgatccaatactgctcatggcgactaaaaatagtggacttgggagcactgatggatggtacttggata |
47534322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University