View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18728_low_11 (Length: 370)
Name: NF18728_low_11
Description: NF18728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18728_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 352
Target Start/End: Original strand, 3912492 - 3912826
Alignment:
| Q |
18 |
ataatgtcaccttcaatgttgttgcactgtgagtttccttggacactaaattattaattaatcttcttcgcctttattgtcagtgaataacaatcaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3912492 |
ataatgtcaccttcaatgttgttgcactgtgagtttccttggacactaaattattaattaatattcttcgcctttattgtcagtgaataacaatcaattt |
3912591 |
T |
 |
| Q |
118 |
atatgatttcagcaatctttctggtttgaatcttgatggcgaaatttcgcctgcaatagggaaacttcaaagcttggtgtctatgtaagtaattttatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3912592 |
atatgatttcagcaatctttctggtttgaatcttgatggcgaaatttcgcctacaattgggaaacttcaaagcttggtgtctatgtaagtaattttatgt |
3912691 |
T |
 |
| Q |
218 |
catctttaacactatttttcatttcattcattgttgttttttgcttatccttctttgtaacttgtttgatacagcgatttaaaacaaaatcggttatcag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3912692 |
catctttaacactatttttcatttcattcattgttgttttttgcttatccttctttgtaacttgtttgatacagcgatttaaaacaaaatcggttatcag |
3912791 |
T |
 |
| Q |
318 |
gtcagataccagacgagattggcgactgctctctg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3912792 |
gtcagataccagacgagattggcgactgctctctg |
3912826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University