View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18728_low_18 (Length: 285)
Name: NF18728_low_18
Description: NF18728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18728_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 10 - 274
Target Start/End: Original strand, 31954075 - 31954339
Alignment:
| Q |
10 |
catcatcataccttccattgccaccatcaaaccttcccccttcattgctgcaatccctagctatgtgacccacctcaccgcacttatagcaagcgccgcc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954075 |
catcatcataccttccattgccaccatcaaaccttcctccttcattgctgcaatccctagctatgtgacccacctcaccgcacttatagcaagcgccgcc |
31954174 |
T |
 |
| Q |
110 |
tccaccacctccgctactaggagtagcgcaatctcttgctatgtgaccaaccccaccacacctgtagcaagatgtgcttccaccaccatatccaccgcca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31954175 |
tccaccacctccgctactaggagtagcgcaatctcttgctatgtgaccaaccccaccacacctgtagcaagatgtgcctccaccaccatatccaccgcca |
31954274 |
T |
 |
| Q |
210 |
ccgttgttgttgttaccgcctccacgcatgcaatccctagcaaaatgttcaaaagaaccacaggt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954275 |
ccgttgttgttgttaccgcctccacgcatgcaatccctagcaaaatgttcaaaagaaccacaggt |
31954339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University