View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18728_low_25 (Length: 237)
Name: NF18728_low_25
Description: NF18728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18728_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 35867773 - 35867988
Alignment:
| Q |
14 |
atcatgatctaggcctcggtgagaaccatgaaattgaaatgggatcagcccacgagcatcaattgggacaaacgcatgagcatgaactggacttgggacc |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35867773 |
atcatgatctaggtctcggtgagaaccatgaaattgaaatgggatcagcccacgagcatcaattgggacaaactcatgagcatgaactggacttgggacc |
35867872 |
T |
|
| Q |
114 |
aacccatgaacatgaactggacttgggacaaacccatgagcatgtactggacttgggacatgatattgacaataacatgggattagaacaaaatcattgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35867873 |
aacccatgaacatgaactggacttgggacaaacccatgagcatgtactggacttgggacatgatattgacaataacatgggattagaacaaaatcatgct |
35867972 |
T |
|
| Q |
214 |
caagaaggtgatgatg |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35867973 |
caagaaggtgatgatg |
35867988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University