View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18728_low_29 (Length: 214)
Name: NF18728_low_29
Description: NF18728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18728_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 5 - 214
Target Start/End: Original strand, 55690434 - 55690646
Alignment:
| Q |
5 |
tgtcgaacaatattcaatgaaaga---agtttatatatttcgtaaatattgacactaaaattctgaaaatgcaaatgggttcttgggttcttttagaaat |
101 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55690434 |
tgtcaaacaacattcaatgaaagagaaagtttatatatttcgtaaatattgaaactaaaattctgaaaatgcaaatgggttcttgggttcttttagaaat |
55690533 |
T |
 |
| Q |
102 |
gagtattagggtgttactgtttccaaaatatgtgattgatgagtgtgaatacatgagacctggaaacatcagaatttggaatttacaagcgagattgcag |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
55690534 |
gagtattagggttttactgtttccaaaatatgtgattgatgagtgtgaatacatgagacctggaaacatcagaatttggaatttacaagagagcttgcag |
55690633 |
T |
 |
| Q |
202 |
ctgattctaaatt |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
55690634 |
ctgattctaaatt |
55690646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University