View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18729_high_14 (Length: 203)
Name: NF18729_high_14
Description: NF18729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18729_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 185
Target Start/End: Original strand, 44587566 - 44587741
Alignment:
| Q |
10 |
catcatcaaaataggagaggataacagggaaatgaatagagtatacctatgagatcgactactgcggtcgttgagggcggttgctccaactgcacggttc |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44587566 |
catcaccaaaataggagaggataacagggaaatgaatagagtatacctatgagatcgactactgcggtcgttaagggcggttgctccaactgcacggttc |
44587665 |
T |
|
| Q |
110 |
ctgtgcccaaggttcattaggtcgataacatcaaaggttgatgacacagagacaaggcttgcatctggcacactga |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44587666 |
ctgtgcccaaggttcattaggtcgataacatcaaaggttgatgacacagagacaaggcttgcatctggcacactga |
44587741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 54 - 183
Target Start/End: Complemental strand, 39342169 - 39342040
Alignment:
| Q |
54 |
acctatgagatcgactactgcggtcgttgagggcggttgctccaactgcacggttcctgtgcccaaggttcattaggtcgataacatcaaaggttgatga |
153 |
Q |
| |
|
|||| |||||||| || || ||||| || ||||| |||||||| ||||| |||||| | || || |||||||| || || ||||||||| |||||||| |
|
|
| T |
39342169 |
acctgtgagatcggctgctacggtcattaagggctgttgctccgactgcgcggttcttatgacccaggttcatcagttcaataacatcatttgttgatga |
39342070 |
T |
|
| Q |
154 |
cacagagacaaggcttgcatctggcacact |
183 |
Q |
| |
|
|| ||||||||||||||||| ||||| |
|
|
| T |
39342069 |
tacttgaacaaggcttgcatctggtacact |
39342040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University