View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1872_high_5 (Length: 241)
Name: NF1872_high_5
Description: NF1872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1872_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 225
Target Start/End: Complemental strand, 37998970 - 37998749
Alignment:
| Q |
3 |
tgctttttaatccggctagcaaaatttatatacatgactgatttatcctttgaaaggataaatatagaactgtgtagtaccaacattacttattaaaagt |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37998970 |
tgctttttaatccggctagcaaaaattatatacatgactgatttatcctttgaaaggataaatatagaact-tgtagtaccaacattacttattaaaagt |
37998872 |
T |
 |
| Q |
103 |
gtgatgactgtcctgtagattacataaaattacttcaattctttacaaattattattggtgtcgatgtatcagtacgtacccggccggtgtctgtacttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37998871 |
gtgatgactgtcctgtagattacataaaattacttcaattctttagaaattattattggtgtcgatgtatcagttcgtacccggccggtgtctgtacttt |
37998772 |
T |
 |
| Q |
203 |
tatagtaaacgagatttagagtt |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37998771 |
tatagtaaacgagatttagagtt |
37998749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University